What Is The Approximate Size Of Your Pcr Product Based On These Results?
Appl Environ Microbiol. 1998 Oct; 64(ten): 3724–3730.
Bias in Template-to-Production Ratios in Multitemplate PCR
Received 1998 April 13; Accustomed 1998 Jul xiii.
Abstract
Bias introduced by the simultaneous distension of specific genes from complex mixtures of templates remains poorly understood. To explore potential causes and the extent of bias in PCR amplification of 16S ribosomal DNAs (rDNAs), genomic DNAs of two closely and ane distantly related bacterial species were mixed and amplified with universal, degenerate primers. Quantification and comparison of template and product ratios showed that at that place was considerable and reproducible overamplification of specific templates. Variability between replicates also contributed to the observed bias just in a comparatively minor way. Based on these initial observations, template dosage and differences in binding energies of permutations of the degenerate, universal primers were tested every bit 2 likely causes of this template-specific bias by using 16S rDNA templates modified by site-directed mutagenesis. When mixtures of mutagenized templates containing AT- and GC-rich priming sites were used, templates containing the GC-rich permutation amplified with college efficiency, indicating that dissimilar primer binding energies may to a large extent be responsible for overamplification. In contrast, gene copy number was found to exist an unlikely cause of the observed bias. Similarly, distension from Dna extracted from a natural community to which unlike amounts of genomic Deoxyribonucleic acid of a single bacterial species were added did not touch relative product ratios. Bias was reduced considerably past using loftier template concentrations, past performing fewer cycles, and by mixing replicate reaction preparations.
The PCR has become an invaluable tool because of the speed and simplicity with which specific DNA segments can exist amplified from a background of circuitous genomes (three, five). In studies of molecular evolution (29) and microbial ecology (26) this property has facilitated the characterization of both single genes and families of related genes in single or multiple species. This is generally washed by designing degenerate primers which target conserved regions of homologous genes, thereby accelerating the detection, amplification, and, ultimately, sequence analysis of the genes under study.
1 of the most innovative applications of the PCR has been the cataloging of bacterial and archaeal species richness in the environment. Mixtures of 16S rRNA genes amplified from natural communities are considered representative of the native organisms from which they originated. This arroyo has revealed the being of numerous uncultured microorganisms because it circumvents bias introduced by traditional civilization-based methods (vii), which typically detect just a fraction (<1%) of the total bacteria nowadays in an environment (2). The protocols involve extraction of nucleic acids from an environmental sample, PCR amplification of the 16S rRNA genes with universal, degenerate primers, and separation of amplified products past cloning or by denaturing gradient gel electrophoresis (DGGE) (15). Subsequently, clones or bands on DGGE gels can exist used in sequencing and in analyzing phylogenetic diversity. Since in almost cases the ultimate goal is to obtain a picture of microbial customs limerick that is not affected by selective cultivation, the protocols include the implicit assumption that PCR distension gain without major bias; that is, numerically of import organisms in the environment are expected to be represented by dominant clones in libraries or by strong bands on DGGE gels.
The post-obit two major classes of processes may skew template-to-product ratios based on theoretical modeling of PCR: (i) PCR selection and (ii) PCR migrate (29). The first class comprises all mechanisms which inherently favor the amplification of certain templates due to properties of the genes, of their flanking sequences, or of the overall genome. Potentially important contributors to PCR pick amid these mechanisms are preferential denaturation due to overall low GC content, higher binding efficiency of GC-rich permutations of degenerate primers, differential accessibility of rRNA genes within genomes, and correlation betwixt amplification probabilities and gene re-create numbers inside genomes. The 2nd type of bias is assumed to be caused past stochastic variation in the early cycles of the reaction (when amplification still proceeds largely from the genomic templates), and its outcome should therefore non exist reproducible in replicate PCR amplifications. Bias in distension from mixtures of 16S ribosomal DNAs (rDNAs) has but recently begun to be explored experimentally (iv, 6, 21, 27).
In the nearly extensive study to date on bias in amplification of 16S rDNAs, Suzuki and Giovannoni (27) demonstrated that the importance of different bias-causing mechanisms may alter over the grade of an amplification. These authors used combinations of different primers to amplify pairs of PCR products. Nether the atmospheric condition used, primer pairs with high amplification efficiency resulted in reactions entering the plateau phase (i.e., products arriving at saturation concentrations [10−vii M]) (23). Since templates which reach saturation concentrations essentially stop amplifying while others are however increasing (23), a kinetic bias towards i:1 product ratios contained of the starting template concentrations was observed (27). All the same, primer pairs with lower amplification efficiency resulted in product concentrations below the saturation concentrations, and depending on the template pair, either the expected product ratio or bias was observed, for which no caption could be given (27). Similarly, in an attempt to evaluate the effect of 16S rRNA cistron copy number and genome size, Farrelly et al. (half-dozen) noted bias in amplifications from template pairs which could not be explained.
In the present study nosotros investigated the potential extent, causes, and minimization of bias in PCR distension from mixtures of 16S rDNA templates. Distension of full-length genes with commonly used universal, degenerate primers was used to mimic realistic conditions in molecular diversity studies. In all experiments, bias due to template saturation (27) was avoided by adjusting reaction parameters and then that the plateau phase was not reached. Initially, mixtures of genomic DNAs of different species were used to make up one's mind the relative contribution of PCR option and PCR drift to bias in template-to-product ratios. The effect of varying the ratios of rDNA templates in reaction mixtures (factor dosage) and the issue of different AT-GC contents of the degenerate primers were investigated as potential major causes of PCR selection. In addition, the effect of the relative amount of a specific template in a complex mixture (genome dosage) on amplification efficiency was tested past adding different amounts of genomic Dna of one species to nucleic acids extracted from a natural customs. Based on these experiments, we investigated alterations of reaction protocols that may reduce bias in amplification of multitemplate mixtures.
MATERIALS AND METHODS
Bacterial strains and civilisation conditions.
Vibrio fischeri ES1114 and Vibrio anguillarum 775 were generous gifts from Edward Cerise (Academy of Hawaii). Cells were grown at room temperature in SWT medium containing (per liter) 5 g of Bacto Tryptone (Difco), three g of yeast extract (Difco), iii ml of glycerol, 700 ml of seawater, and 300 ml of distilled water. Escherichia coli INVαF′ was purchased from Invitrogen and was grown in Luria-Bertani goop (22).
Nucleic acid extraction.
DNAs from both Vibrio strains and from E. coli were extracted and purified by the method of Jarrell et al. (eight), with slight modifications (17). Purified Dna from Bacillus subtilis RL202 was a generous souvenir from Len Duncan (Harvard University). Community nucleic acids were extracted from a coastal microbial customs (Forest Hole, Mass.). Cells from 20 liters of prefiltered (pore size, 1 μm) h2o were concentrated with a 0.22-μm-pore-size Micro Civilization Capsule filter (Gelman Sciences) in September 1994 provided by Meredith Hullar (Harvard University). Cells were lysed by incubation with sodium dodecyl sulfate and proteinase K freeze-humid cycles as described previously (xvi) followed by standard phenol-chloroform extraction (22).
PCR primers.
Primers 27F and 1492R (Tabular array 1) were used for amplification from genomic DNA and from PCR products in experiments performed to decide the causes and extent of bias; these primers are frequently used in molecular diversity studies considering they result in a most total-length 16S rDNA product and are considered universal for the domain Bacteria and for the domains Archaea and Bacteria, respectively (xi). Each primer contains a single degeneracy, which is between A and C at position 19 (E. coli numbering) in primer 27F and between T and C at position 1497 in primer 1492R (Table 1).
TABLE i
Designations and targets of amplification primers and hybridization probes
| Primer or probe | Sequencea | Positionsb | Target |
|---|---|---|---|
| Primers | |||
| 27F | AGAGTTTGATC(C/A)TGGCTCAG | eight–27 | (Eu)bacterial 16S rDNA |
| 27F(A) | AGAGTTTGATCA TGGCTCAG | 8–27 | (Eu)bacterial 16S rDNA containing T at position 19 |
| 27F(C) | AGAGTTTGATCC TGGCTCAG | eight–27 | (Eu)bacterial 16S rDNA containing G at position 19 |
| 1492R | TACGG(C/T)TACCTTGTTACGACTT | 1492–1513 | (Eu)bacterial 16S rDNA |
| 1492R(T) | TACGGT TACCTTGTTACGACTT | 1492–1513 | (Eu)bacterial 16S rDNA containing T at position 1497 |
| 1492R(C) | TACGGC TACCTTGTTACGACTT | 1492–1513 | (Eu)bacterial 16S rDNA containing C at position 1497 |
| Probes | |||
| Bsu | CGCGGGTCCATCTGTAAGTG | 219–238 | B. subtilis 16S rDNA |
| Van | CCTAGGCATATCCTGACGCG | 219–238 | V. anguillarum 16S rDNA |
| Vfi | CCTGGGCTAATCTTAGCGCG | 219–238 | V. fischeri 16S rDNA |
| Eco | CTTTACTCCCTTCCTCCCCG | 443–462 | E. coli mutagenized 16S rDNA with C [Eco(GC)] or A/T [Eco(AT)] in priming regions |
| EcoM | CTTTACTGGGAAGCTCCCCG | 443–462 | E. coli mutagenized 16S rDNA with A/T in priming region and nucleotides 450 to 455 exchanged [Eco(AT)m] |
| Eubc | GCTGCCTCCCGTAGGAGT | 338–355 | (Eu)bacterial 16S rDNA |
PCR templates.
Amplifications with primers 27F and 1492R were conducted with the post-obit template mixtures: (i) three bacterial genomic DNAs, (ii) purified PCR products of different mutagenized E. coli 16S rDNAs, and (iii) 5. anguillarum DNA and nucleic acids extracted from the aquatic customs.
(i) Genomic DNAs.
In experiments performed to determine PCR migrate and selection and reduction of bias, the template used consisted of a mixture of equal amounts (every bit determined by spectrophotometry) of total genomic DNAs of B. subtilis, V. anguillarum, and V. fischeri.
(ii) Mutagenized East. coli 16S rDNAs.
The effects of primer degeneracies and gene dosage were determined with pairwise mixtures of three mutagenized Due east. coli 16S rDNA templates, Eco(GC), Eco(AT), and Eco(AT)m. Eco(GC) and Eco(AT) differed only at the single degenerate position in each of the priming sites for 27F and 1492R (Table one). Eco(AT)k differed from Eco(AT) and from Eco(GC) as follows: six nucleotides in the middle of the molecule were contradistinct past site-directed mutagenesis. Eco(GC) and Eco(AT)m templates were mixed in equal amounts in the primer degeneracy experiments, and Eco(AT) and Eco(AT)one thousand were mixed at 1:1, ane:v, 1:x, and one:twenty ratios in the gene dosage experiments.
The three mutagenized templates were generated every bit follows. Nondegenerate versions of primers 27F and 1492R (Table one) were used in two combinations, 27F(A)-1492R(T) and 27F(C)-1492R(C). The resulting PCR products, Eco(AT) and Eco(GC), were cloned. Subsequently, in a cloned Eco(AT) 16S rDNA fragment, nucleotides 450 to 455 were inverse to their complements past using a PCR site-directed mutagenesis protocol (7a). First, a reaction was carried out with a mutagenesis primer (TTAACTTTACTGGGAAGCTCCCCGCTGA; positions 439 to 466) and primer 27F(A) (Table 1), which created a 458-bp product. This product was gel purified and used as a primer in a second reaction together with primer 1492R(T) (Table 1). The mutagenized 16S rDNA was cloned and is referred to beneath every bit Eco(AT)g.
The furnishings of primer degeneracies and cistron dosage were tested by using PCR products amplified from the Eco(GC), Eco(AT), and Eco(AT)one thousand clones equally templates. These products were generated with primers M13 reverse and M13(−40), which resulted in 16S rRNA gene fragments flanked by roughly 200 bp of plasmid-derived sequence, allowing purification of amplification products from templates before blotting and quantitative assay. In all cases, templates were generated from clones in which the 16S rDNAs had the same orientation to avoid any potential influence of different flanking sequences on primer hybridization during the PCR. PCR products were quantified by comparison with standards on an agarose gel past using the Eagle Heart gel imaging and quantification organisation (Stratagene).
(iii) V. anguillarum and customs DNA.
The influence of the relative corporeality of a specific template in a complex mixture on product distribution was tested with a mixture of V. anguillarum Deoxyribonucleic acid and nucleic acids extracted from a natural community. Both types of nucleic acids were quantified spectrophotometrically, and the template mixture was generated by calculation V. anguillarum Dna to concluding concentrations of 10, 1, and 0.i%.
PCR conditions.
All reactions were performed with a Twin Block System and a Ability Block I Arrangement thermal cycler (Ericomp). The reaction volume was either 100 or 25 μl, and each reaction mixture contained i× PCR buffer (50 mM KCl, 10 mM Tris-HCl, 1% Triton Ten-100), each deoxynucleoside triphosphate at a concentration of 200 μM, 2.0 mM MgCl2, 5% acetamide (in reactions in which genomic Dna was the template), each primer at a concentration of 100 pM, and 0.025 U of Taq polymerase (Promega) per μl. Acetamide was included in the reaction mixtures containing genomic DNAs because it has been reported to increase denaturation of templates with loftier GC contents during the PCR temperature cycles (21). For replicate PCR amplifications, aliquots were taken from a unmarried chief mixture. The template concentration used was 0.1 ng of total genomic Dna per μl or five pg of purified PCR production per μl in 25-cycle amplifications and 5 ng of total genomic DNA per μl in 5- and 10-cycle amplifications.
All amplifications started with an initial denaturation footstep consisting of 94°C for three min; this was followed by cycles consisting of 1 min at 94°C, i min at fifty°C, and 2 min at 72°C. To avert bias associated with product saturation (27), the amounts of product accumulated after different numbers of cycles with each of the different template combinations were adamant by spectrophotometry and by liquid scintillation counting of incorporated 32P-labeled dCTP (12). This showed that after 25 cycles the products were still beingness produced exponentially (data not shown). Thus, the number of cycles used in the experiments designed to identify the extent and possible mechanisms of bias was 25. In other experiments, the numbers of cycles were decreased to 5 and 10 in club to determine the effect of fewer cycles on product bias. To avoid false priming of the genomic templates at depression temperatures (three, five), a type of hot-start PCR was used. In each amplification tube, a lower reservoir containing water, buffer, and enzyme was created past sealing it off with 50 μl of molten Paraplast wax. After solidification of the wax, the rest of the reagents were added to the tube and sealed with an additional 50 μl of molten wax. This wax had a melting point of 56°C and floated to the top of the liquid during the initial denaturation stride of the amplification.
Oligonucleotide probe design, labeling, and conclusion of Td and specificity.
Specific oligonucleotide probes for the dissimilar bacterial species were designed based on an alignment obtained from the Ribosomal Database Project (RDP) (xiii). For differentiation of the Vibrio species and B. subtilis, a 20-nucleotide stretch was identified (positions 219 to 238 [East. coli numbering]) which had the same GC content (60%) (Table 1). Probes Eco and EcoM were designed to differentiate the native Due east. coli 16S rDNA template from mutagenized versions (Table i).
The midpoint dissociation temperatures (Td s) of oligonucleotides were determined experimentally to optimize the relationship between signal strength and specificity of the probes as described by Raskin et al. (xx), with modifications (18). Each nucleic acid blazon was blotted in duplicate with a Minifold I dot blotter (Schleicher & Schuell) onto Zetaprobe nylon membranes (Bio-Rad) by using the alkaline denaturation method performed according to the instructions supplied. The oligonucleotide probes were labeled with polynucleotide kinase (Gibco BRL) then that they contained 5 × 106 cpm/pmol and were purified with NenSorb 20 cartridges (Du Pont NEN). Hybridizations were performed at 30°C overnight in the recommended buffer (Zetaprobe) by using the specific probes. Afterwards, the membranes were washed twice for 15 min at the same temperature. Individual dots were then cut out and done in 2 ml of wash buffer in 7-ml scintillation vials which had been prewarmed in water baths at temperatures ranging from 20 to 65°C at 2 to 5°C intervals. After 10 min the membranes were removed, and the amounts of radioactive decay in the launder solutions and on the membranes were adamant past liquid scintillation counting. The Td s were calculated by dividing the counts remaining on each membrane by the total counts for each temperature bespeak. The resulting values were and then plotted every bit percentages of probe washed off versus temperature, and the 50% value was considered the Td .
Probe specificity was determined (i) past hybridizing the Van, Vfi, and Bsu probes with a blot containing both genomic DNAs and PCR-generated 16S rDNAs of the three species and (ii) past hybridizing the Eco and EcoM probes with a blot containing PCR products of native and mutagenized Eastward. coli 16S rDNAs. The blots were hybridized and done by using the conditions specified above except that the 15-min specific wash was at the Td only. Specific labeling and groundwork were determined past exposing membranes on Reflection NEF-496 (Du Pont) Ten-ray film and by quantification of the radioactive decay by using a Fujix BAS200 phosphorimager and BAS2000 Image File Managing director 2.1 analysis software.
Quantitative dot blot hybridizations.
Quantitative dot blot hybridizations were carried out to determine 16S rDNA template and product ratios. Membranes were blotted with template and/or PCR product combinations and hybridized with specific probes every bit follows: (i) for PCR migrate and PCR selection tests, iii identical blots containing a mixture of 3 genomic templates (V. anguillarum, V. fischeri, and B. subtilis), v individual replicate amplifications (PCR ane to 5), and a mixture of 10 replicate amplifications (PCR mixture) hybridized with probes Bsu, Van, and Vfi; (ii) for primer degeneracy tests, two identical blots containing a i:1 mixture of Eco(GC) and Eco(AT)1000 mutagenized E. coli 16S rDNA templates and five replicate amplifications after xv, 25, and 35 cycles hybridized with probes Eco and EcoM; (3) for gene dosage tests, two identical blots containing 5 replicate amplifications from ane:i, ane:5, 1:x, and 1:20 template mixtures of Eco(AT) and Eco(AT)yard mutagenized East. coli 16S rDNA fragments hybridized with probes Eco and EcoM; (4) for genome dosage tests, two identical blots containing three replicate amplifications from nucleic acids extracted from a natural community to which V. anguillarum DNA had been added at concentrations respective to 0.1, i, and ten% of the total amount hybridized with probes Van and Eub; and (v) for a test of reduced bike numbers, three identical blots containing the original three-genomic-template mixture (V. anguillarum, 5. fischeri, and B. subtilis) and mixtures of ten replicate amplifications after five and ten cycles hybridized with probes Bsu, Van, and Vfi.
Before blotting, PCR products were purified from templates on 0.8% agarose gels (Qiaquick; Qiagen). In experiments in which 10 replicate PCR amplifications were mixed, the products of the reactions were concentrated individually by using Microcon 100 filtration devices (Amicon), purified, and eluted from 0.8% agarose gels. Then, after their concentrations were determined by spectrophotometry, subsamples of each of the 10 PCR amplifications containing equal amounts of DNA were mixed and blotted (PCR mixture).
In the experiments performed to explore PCR drift and PCR selection, three membranes containing nine replicate dots of each of the 3 classes of nucleic acids (template mix, PCR i to 5, and PCR mixture) were blotted. In the experiments designed to test the influence of reduced cycle numbers, three identical membranes containing eight replicate dots of the template mixture and the product mixture from ten replicate PCR carried out for five and ten cycles were blotted. This resulted in standard deviations for the replicate dots that were less than 5% of the hateful for all samples spotted with nine and eight replicates. In all other experiments, two membranes were blotted with three replicate dots per class of nucleic acid. For 37 of the 76 samples in which three replicates were used the standard deviations were less than 5% of the mean. For most of the remainder of the samples the standard deviations were less than x%; the just exceptions were two samples which had standard deviations of 12 and 16%.
All hybridizations were carried out as described above, using a 10-fold tooth backlog of probe over target and 1 ml of hybridization buffer per dot. Bound probe was quantified by phosphorimaging, and average signals were calculated for each specific template or PCR product in the different classes of nucleic acids (e.chiliad., B. subtilis in template mixture, in PCR mixture, or in replicate PCR). Afterwards, pairwise ratios of the averages (e.g., B. subtilis signal over V. fischeri indicate in PCR mixure) were determined. To facilitate interpretation, the PCR production signals were normalized to the template mixture bespeak by computing a constant factor for each template pair. For instance, the ratio of ane.i obtained from the hybridization intensities of the genomic mixture with the B. subtilis-5. anguillarum pair was multiplied past 0.91 to normalize it to 1.0. Subsequently, all other ratios (PCR mixture, PCR 1 to 5) determined for this species pair were multiplied by the same factor. In cistron and genome dosage experiments in which PCR product ratios were compared to i some other, signal ratios were corrected for differences in specific activities of the hybridization probes. Standard deviations of the ratios were calculated from all possible combinations of denominators and numerators in a given experiment and generally were less than 10% of the average.
Nucleic acrid sequencing.
The 16S rRNA genes of all three species were sequenced partially to ensure sequence identity between all of the strains used in this study and the strains represented in the RDP. Three clones of each species were sequenced past using primer 519R (11), which covers two of the most variable regions in the 16S rRNA molecule. Furthermore, sequences in the 1492R priming region of the two Vibrio species were determined since they were not bachelor in the databases. A 16S rDNA fragment was amplified by PCR as specified above, except that primer 1525R (11) was used in place of 1492R. The resulting product was purified and cloned into the PCR II vector (Invitrogen, San Diego, Calif.). Three clones of each of the Vibrio species were sequenced past using primers 1406F and 1525R (eleven).
All of the clones resulting from the in vitro mutagenesis experiments were checked by sequencing for the correct, expected sequence by using M13 primers or internal 16S rDNA primers (11).
RESULTS
Td and specificity of oligonucleotides.
The experimentally determined Td s for oligonucleotide probes Bsu, Van, Vfi, Eco, and EcoM were 52.v, 53.0, 46.2, 49.0, and 44.one°C, respectively (data non shown). These temperatures were used in the loftier-temperature launder step of the quantitative dot absorb hybridizations.
Under the weather used, all of the probes reacted specifically with their target molecules (Fig. ane). No groundwork was observed with probe-target mismatches with either the different genomic DNAs or the PCR. X-ray films remained completely clear afterwards 5-h exposures. Likewise, quantification by phosphorimaging yielded groundwork values just for the exposure times used for the quantitative analysis (data not shown).
Dot blot analyses showing the specificity of the oligonucleotide probes for their targets. (A) Genomic DNAs (left dots) and PCR-amplified 16S rDNAs (right dots) of B. subtilis, V. fischeri, and 5. anguillarum were blotted together on three replicate membranes and hybridized with the specific probes Bsu, Van, and Vfi, respectively. (B) PCR-amplified 16S rDNAs of mutagenized plasmids Eco(GC), Eco(AT), and Eco(AT)yard were blotted on ii split up membranes and hybridized with the specific probes Eco and EcoM, respectively. The electronic prototype was taken from X-ray film exposed for 5 h.
Quantification of PCR bias.
The underlying rationale of the initial experiments was that if bias in PCR amplifications is due to stochastic fluctuations (PCR drift), it would not be reproducible in replicate reactions, whereas if it is a belongings of the templates (PCR selection), the same pattern of bias would be observed in private amplifications. When betoken ratios for the different species pairs were compared, the ratios of the genomic templates never corresponded to the ratios of the PCR products (Table 2). If all three templates had been amplified with the same efficiency, all of the ratios should take been like to the ratios of the genomic DNAs. The error due to betwixt-dot variability in the hybridizations was small because a large number of replicates were blotted for all treatments. The largest bias was observed for B. subtilis 16S rDNA, which was amplified with much higher efficiency than the DNAs of the ii Vibrio species. When the two Vibrio templates were compared, V. anguillarum Deoxyribonucleic acid was amplified less than V. fischeri DNA and overall was the least-well-represented Deoxyribonucleic acid (Table 2). A detailed comparing also revealed variation amidst the ratios of the individual PCR products (Table 2). Most values remained within ±0.three unit of the PCR mixture. Yet, some extreme cases occurred, as illustrated by the B. subtilis-V. fischeri pair in PCR 5, which differed i.ii-fold.
Table 2
Comparison of 16S rDNA gene template and PCR product ratios in simultaneous PCR amplifications of three bacterial genomes with degenerate primersa
| Prepn | Species ratiosb | ||
|---|---|---|---|
| B. subtilis/ 5. fischeri | B. subtilis/ V. anguillarum | V. fischeri/ Five. anguillarum | |
| Genomic mixture | 1.0 ± 0.06 | one.0 ± 0.08 | one.0 ± 0.07 |
| PCR mixture | 2.3 ± 0.18 | 3.2 ± 0.29 | i.iv ± 0.13 |
| PCR i | 2.3 ± 0.12 | 3.7 ± 0.18 | 1.6 ± 0.09 |
| PCR 2 | 2.2 ± 0.13 | three.2 ± 0.21 | 1.iv ± 0.09 |
| PCR 3 | 2.five ± 0.17 | 3.2 ± 0.31 | 1.3 ± 0.12 |
| PCR 4 | ii.0 ± 0.15 | three.five ± 0.35 | ane.viii ± 0.fifteen |
| PCR five | three.5 ± 0.25 | three.5 ± 0.30 | i.0 ± 0.08 |
The GC content of the priming region had a meaning issue on the efficiency of distension of the templates studied. In 1:one mixtures of a pair of mutagenized E. coli 16S rDNAs [Eco(GC) and Eco(AT)m], the template with the GC-rich permutation in the priming site was consistently amplified better than the AT-rich permutation (Table three). This unequal effectiveness of amplification increased with cycle number (Table 3); the average product ratios were 1.iv, ane.7, and 2.ii after xv, 25, and 35 cycles, respectively.
Table iii
Effect of primer degeneracies on PCR product ratiosa
| Prepn | Eco(GC)/Eco(AT)1000 ratiob | ||
|---|---|---|---|
| 15 cycles | 25 cycles | 35 cycles | |
| Template mixture | 1.0 ± 0.04 | i.0 ± 0.04 | 1.0 ± 0.04 |
| PCR 1 | ane.4 ± 0.16 | 1.5 ± 0.06 | 2.iii ± 0.10 |
| PCR 2 | one.iv ± 0.14 | 1.8 ± 0.11 | 2.3 ± 0.07 |
| PCR iii | 1.three ± 0.11 | 1.vii ± 0.07 | two.5 ± 0.20 |
| PCR four | 1.four ± 0.26 | i.nine ± 0.07 | 1.9 ± 0.fourteen |
| PCR v | 1.three ± 0.sixteen | 1.viii ± 0.09 | 2.0 ± 0.17 |
Gene dosage alone had no discernible effect on product ratios (Fig. 2). Two mutagenized E. coli 16S rDNA templates, Eco(AT) and Eco(AT)thou, which differed merely in the six nucleotides recognized past probes Eco and EcoM, respectively, were mixed at ratios of 1:ane, 1:5, i:10, and 1:xx. Least-squares linear regression assay of the average product ratios for 3 replicate amplifications per ratio indicated that amplification was proportional to template representation (r 2 = 0.998) (Fig. 2).
Upshot of cistron dosage as determined by amplification with dissimilar template ratios of Eco(AT) and Eco(AT)m and quantification of product ratios by quantitative dot blotting with probes Eco and EcoM. Regression analysis showed that the relationship between template and product ratios was linear. The vertical bars bespeak standard deviations.
Genome dosage also did not influence product ratios to a large and consistent extent nether the conditions used (Table 4). 5. anguillarum genomic Deoxyribonucleic acid was added at concentrations equivalent to 10, one, and 0.ane% of the total Deoxyribonucleic acid to Dna extracted from a natural microbial community and was amplified with the universal primers. The product ratios determined with the specific probe Van and the universal (european union)bacterial probe Eub (Tabular array i) (i) indicated that proportional amplification occurred (Tabular array 4). The values for the product ratios at the x% dilution were approximately 10 times college than the values at the 1% dilution (Table 4). However, the coefficient of variation of the product ratios for the three replicate amplifications increased from 3% at the 10% dilution to 12% at the 1% dilution, indicating that at that place was a lower level of reproducibility at the lower template concentration. Ratios for the 0.1% dilution could not be adamant considering there was non enough V. anguillarum production.
Tabular array 4
Reproducibility of PCR amplification of a single template in a complex mixture of nucleic acids from a natural communitya
| Prepn | V. anguillarum/(european union)bacterial 16S rDNA ratiob | ||
|---|---|---|---|
| 10% V. anguillarum | 1% V. anguillarum | 0.1% V. anguillarum | |
| PCR 1 | 0.156 ± 0.008 | 0.017 ± 0.001 | NDc |
| PCR two | 0.147 ± 0.011 | 0.020 ± 0.000 | ND |
| PCR three | 0.153 ± 0.005 | 0.016 ± 0.001 | ND |
To exam the hypothesis that accumulation of bias is largely template inherent and condiment with every bicycle, the consequence of decreasing the number of cycles on PCR product ratios was examined. The same three-species mixture was used in these experiments. While the same design of overamplification was observed, the differences between template ratios and PCR mixture ratios were considerably smaller in all cases (Table 5). Indeed, the product ratio approached the template ratio when the numbers of cycles were 10 and 5 (Table v).
Tabular array v
Result of lower number of cycles of the PCR on skewing of product ratiosa
| Prepn | Species ratiosb | ||
|---|---|---|---|
| B. subtilis/ V. fischeri | B. subtilis/ V. anguillarum | 5. fischeri/ V. anguillarum | |
| Genomic mixture | 1.0 ± 0.05 | 1.0 ± 0.06 | 1.0 ± 0.05 |
| PCR mixture, ten cycles | ane.7 ± 0.ten | two.2 ± 0.x | 1.3 ± 0.04 |
| PCR mixture, 5 cycles | 1.iii ± 0.15 | 1.5 ± 0.fourteen | ane.1 ± 0.05 |
DISCUSSION
The results of this written report indicate that PCR product ratios tin be significantly biased in standard amplifications of mixed templates (Table 2). Nether the experimental weather used, mechanisms summarized nether PCR drift appeared to cause little bias, but occasional extremes occurred (e.yard., PCR 5 in Table 2). PCR option emerged as the strength driving diff distension of templates, and unlike binding energies of degenerate primers were a major contributor (Table 3). Considerable bias was observed even though the effects of PCR selection may have been balanced to a large extent past kinetic bias as observed past Suzuki and Giovannoni (27) (i.eastward., progressive reduction in the amplification efficiency of specific products). Overall, the results suggest that product distributions are reproducible despite being biased in an a priori unpredictable mode. In addition, the effects of PCR choice tin can be reduced past performing short-bicycle PCR amplifications with high template concentrations (Table 5).
PCR migrate.
The observed deviations could exist caused by (i) true PCR drift rooted in the reaction mechanism and (2) errors perceived as PCR migrate just actually introduced by the experimenter. A depression template concentration in the early on cycles may lead to stochastic fluctuation in the interactions of PCR reagents, especially primer annealing to the genomic template. In the experiments presented here, PCR drift may actually take been minimized because templates were added at relatively high starting concentrations (Tabular array two). However, in other investigations performed to test the effect of low template concentrations, product distribution and yield exhibited very low reproducibility, and some specific products were missing from some replicate amplifications (4, 9, 14). Perceived PCR migrate may stem from pipetting errors betwixt replicates, from variations in the thermal profiles of different wells, or from unequal ramping temperatures in thermal cyclers, which may affect templates differentially. While the first possibility was minimized by using master mixtures, we have no means of differentiating the second possibility from truthful PCR drift. However, independent of the causes, the data emphasize the danger of using a unmarried PCR amplification for analysis of microbial communities past cloning or DGGE because the variation between replicates is unpredictable and can be large (Table 2).
PCR selection.
PCR pick may be caused to a large extent past differences in the GC content at degenerate positions in the primer target sites in the 16S rDNAs. This was indicated by the occurrence of bias in the production pairs of the three species and of the East. coli 16S rDNAs, which were mutagenized to differ essentially simply in the amplification sites (Tables 2 and iii). The consistent overamplification of the B. subtilis template may also accept been largely due to higher primer affinity for the priming region due to higher GC content. Inspection of the sequences in the RDP database and partial sequencing indicated that at both degenerate positions of the 2 primers B. subtilis has a G, whereas the two Vibrio species have an A or T (Fig. 3). This sequence variation is reflected in the widely used 16S rDNA distension primers 27F and 1492R (11), each of which contains a single degeneracy (betwixt A and C and betwixt T and C, respectively) (Table 1; Fig. 3). Considering both G and C form a triple hydrogen bond, the melting temperatures of the GC-rich permutations of both primers are theoretically about 2°C college than the AT-rich permutation. Thus, at each annealing pace a greater proportion of the templates containing GC complements in the priming region should hybridize to their matched primers. The alternative explanation for the observed continuous buildup of bias (Tables 2 and 3) is that AT-containing primers are more constructive than GC-containing primers in forming mismatched hybrids. All the same, due to the much lower thermal stability of mismatches, this possibility appears less likely. The unexplained bias observed in other studies (6, 27) may also take been due to primer degeneracy effects, only interpretation of the data is hampered past a lack of sequence information in the databases for the templates used.
Alignment of the sequences of universal amplification primers 27F and 1492R and their target regions on the 16S rRNA genes of B. subtilis, V. fischeri, and V. anguillarum. The ii primers each comprise a unmarried degeneracy (betwixt C and T and between C and A, respectively). In the B. subtilis gene both priming sites comprise a K at the degenerate site, which most likely results in a higher melting temperature for the primer-target duplex than the melting temperature for the two Vibrio genes, which contain an A and a T at the two positions.
PCR bias due to gene and genome dosage effects was not detected (Fig. two, Table 4). Farrelly et al. (half-dozen) have suggested that such dosage effects cause bias (6) and have argued that 16S rDNAs from species with higher rrn operon numbers should be amplified better than 16S rDNAs from species with lower rrn operon numbers. Indeed, a like explanation for the overamplification of the B. subtilis 16S rDNA from the mixture containing three species (Table 2) could non be ruled out a priori. Total genomic DNAs were mixed at a ratio of i:1:1, and both operon number and genome size could have skewed the product distribution in favor of B. subtilis. This species has 10 rrn operons and a genome size of 4,165 kb (6); in contrast, Five. fischeri has only viii rrn operons (10) and a slightly larger genome (4,550 kb) (24) (no rrn operon data are available for V. anguillarum). However, a strong effect of gene copy number or genome re-create number in amplification was not supported past our experiments. Regression analysis of the products amplified with the different template ratios gave no indication of departure from a linear relationship (Fig. 2). Similarly, different amounts of the V. anguillarum genome in a complex community resulted in no major or consequent amplification bias (Table 4). Whether equally high levels of reproducibility occur with templates nowadays at much lower levels, such as V. anguillarum added at a concentration equivalent to 0.1% of the total community DNA concentration, could non be tested by the quantitative hybridization approach used here.
Two lines of evidence point to the existence of additional factors that crusade PCR selection in addition to primer degeneracies. Start, when 25 cycles were used, the boilerplate B. subtilis/V. fischeri ratio was 2.three (Table two), whereas the average Eco(GC)/Eco(AT)m ratio was only ane.7 (Table iii), suggesting that primer degeneracies accounted for only nearly one-one-half of the overamplification. 2d, there was as well bias with the closely related Vibrio species (Table ii). Both of these species have the same sequence in the priming sites (Fig. 3), and their 16S rDNAs are 93.ix% identical, nevertheless the Five. fischeri template was consistently amplified better (Tables ii and 5). Although it is impossible to determine a definitive cause, a number of additional factors may have contributed to the bias observed. Sequence regions immediately adjacent to the priming sites may take influenced the hybridization efficiency of the primers, as suggested by Td studies of universal oligonucleotide probes with different templates (xxx). Unmarried strands of 16S rDNA are potentially prone to secondary-structure formation during production extension, which may cause the polymerase to fall off. Furthermore, differences in the GC contents of the 16S rDNA templates or the whole genomes may lead to differential denaturation of templates. Nonetheless, in the case of the vibrios, the GC contents are merely slightly different; Five. fischeri genomes comprise 39 to 41% GC, whereas V. anguillarum genomes contain 43 to 44% GC. If overall differences in GC content, likewise as the specific priming sites, are a cause of product bias, this problem may be exaggerated in natural samples, in which the differences betwixt genomes typically far exceed the 5% maximum difference betwixt the ii Vibrio species examined.
Reduction of PCR bias.
The effects of PCR bias were decreased by (i) mixing several replicate PCR amplifications and (ii) reducing the numbers of cycles. The five replicate amplifications which were assayed individually showed good agreement with the PCR mixture, which was a composite of 10 replicate amplifications (Table 2). Thus, as suggested by Chandler et al. (4), pooling replicates may be an effective way to decrease variation in the amplification process; this is especially true for those templates which are present at depression initial concentration in the sample. Reduction of the number of cycles had the most dramatic effect (Table five). Overamplification of the Bacillus template was reduced to ratios of i.seven and 2.2 with ten cycles and decreased to ratios of ane.3 and 1.v with 5 cycles (Table 5). The bias between the 2 Vibrio species was likewise reduced, and the ratio was close to the original template ratio (Table five).
Recommendations and conclusions.
The following recommendations for limiting bias in PCR amplifications emerged from the data presented above. First, whenever possible, degeneracies should be avoided when universal primers are designed. Second, to increment reproducibility between replicates, amplifications should be carried out by using high template concentrations. Third, to minimize PCR drift, several replicate PCR amplifications should be combined. Fourth, to diminish PCR selection, the smallest number of cycles should be used. Since cloning utilizes but a very pocket-size corporeality of Deoxyribonucleic acid, 10 cycles or even five cycles may exist enough if a high template concentration (>500 ng of genomic DNA per tube) is used. In a PCR which started with 500 ng of template, after 10 cycles a discrete band on a standard agarose gel was easily detectable with a subsample as small as 5 μl (unpublished observations). Alternatively, combining several replicates should yield enough product to be analyzed by electrophoretic methods, such every bit DGGE.
Overall, the results bespeak that PCR analysis is a method with relatively high precision but potentially low accuracy; that is, production distributions are reproducible, just template-inherent factors may lead to significant deviations from template distributions. These results support the validity of quantitative PCR approaches, in which internal standards are added, but show the limitations of multitemplate amplifications. Even in the simple three-species community tested, relatively large PCR selection was observed. How PCR selection volition skew amplifications from natural communities with potentially thousands of species (28) and with templates that may be even more prone to overamplification cannot exist predicted at this time. In addition, estimates of cell numbers based on amounts of products are skewed by the highly variable operon numbers in different species (6, 10). This emphasizes the fact that quantitative interpretation of PCR-based results should nonetheless be viewed with circumspection. In the hereafter, information technology will be important to explore PCR bias further to arrive at measures which consequence in confidence in product distributions in molecular diversity studies of natural communities. Currently, quantitative oligonucleotide probing (18, xix, 25) and in situ hybridization (two) still provide ecologically more meaningful measures of the relative importance of specific microorganisms.
ACKNOWLEDGMENTS
This work was supported past grants from the National Science Foundation and the Role of Naval Enquiry to C.Thou.C.
We give thanks Christopher Harbison for help with sequencing, Charles Harvey and Dennis McLaughlin for aid with statistics, Stephen Giovannoni, Daniel Distel, and Christian Luschnig for critical discussions, and Edward Ruby and Len Duncan for providing the strains used in this study.
REFERENCES
1. Alm W E, Oerther D, Larsen N, Stahl D A, Raskin L. The oligonucleotide database project. Appl Environ Microbiol. 1996;62:3557–3559. [PMC costless commodity] [PubMed] [Google Scholar]
ii. Amann R I, Ludwig W, Schleifer Chiliad-H. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59:143–169. [PMC free article] [PubMed] [Google Scholar]
iii. Arnheim Northward, Erlich H. Polymerase chain reaction strategy. Annu Rev Biochem. 1992;61:131–156. [PubMed] [Google Scholar]
4. Chandler D P, Fredrickson J K, Brockman F J. Event of PCR template concentration on the composition and distribution of total community 16S rDNA clone libraries. Mol Ecol. 1997;half-dozen:475–483. [PubMed] [Google Scholar]
v. Erlich H A, Gelfand D, Sninsky J J. Recent advances in the polymerase concatenation reaction. Science. 1991;252:1643–1651. [PubMed] [Google Scholar]
6. Farrelly V, Rainey F A, Stackebrandt Due east. Effect of genome size and rrn gene copy number on PCR distension of 16S rRNA genes from a mixture of bacterial species. Appl Environ Microbiol. 1995;61:2798–2801. [PMC gratuitous article] [PubMed] [Google Scholar]
7. Caput I One thousand, Saunders J R, Pickup R West. Microbial evolution, diversity, and environmental: a decade of ribosomal RNA assay of uncultivated microorganisms. Microb Ecol. 1998;35:ane–21. [PubMed] [Google Scholar]
7a. Hektor, H. Personal communication.
8. Jarrell K F, Faguy D, Herbert A M, Kalmkoff G L. A general method of isolating loftier molecular weight DNA from methanogenic archaea (archaebacteria) Can J Microbiol. 1991;38:65–68. [PubMed] [Google Scholar]
ix. Karrer E Eastward, Lincoln J East, Hogenhout S, Bennet A B, Bostock R M, Martineau B, Lucas W J, Gilchrist D G, Alexander D. In situ isolation of mRNA from individual plant cells: cosmos of jail cell-specific cDNA libraries. Proc Natl Acad Sci USA. 1995;92:3814–3818. [PMC free commodity] [PubMed] [Google Scholar]
10. Kerkhof L, Speck Thou. Ribosomal RNA gene dosage in marine bacteria. Mol Mar Biol Biotechnol. 1997;six:260–267. [PubMed] [Google Scholar]
11. Lane D J. 16S/23S rRNA sequencing. In: Stackebrandt Due east, Goodfellow M, editors. Nucleic acrid techniques in bacterial systematics. Chichester, Britain: Wiley & Sons; 1991. pp. 115–175. [Google Scholar]
12. Lee S-Y, Bollinger J, Bezdicek D, Ogram A. Estimation of the abundance of an uncultured soil bacterial strain by a competitive quantitative PCR method. Appl Environ Microbiol. 1996;62:3787–3793. [PMC gratis article] [PubMed] [Google Scholar]
thirteen. Maidak B L, Olsen G J, Larsen N, Overbeek R, McCaughey M J, Woese C R. The Ribosomal Database Project (RDP) Nucleic Acids Res. 1996;24:82–85. [PMC free article] [PubMed] [Google Scholar]
xiv. Mutter Grand, Boynton M A. PCR bias in distension of androgen receptor alleles, a trinucleotide repeat mark used in clonality studies. Nucleic Acids Res. 1995;23:1411–1418. [PMC gratis article] [PubMed] [Google Scholar]
15. Muyzer Thousand, de Waal E C, Uitterlinden A G. Profiling of complex microbial populations by denaturing slope gel electrophoresis assay of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol. 1993;59:695–700. [PMC free article] [PubMed] [Google Scholar]
sixteen. Norrman B, Zweifel U L, Hopkinson C S, Fry B. Product and utilization of dissolved organic carbon during an experimental diatom flower. Limnol Oceanogr. 1995;40:898–907. [Google Scholar]
17. Polz M F, Odintsova East 5, Cavanaugh C Thou. Phylogenetic relationships of the filamentous sulfur bacterium Thiothrix ramosa based on 16S rRNA sequence analysis. Int J Syst Bacteriol. 1996;46:94–97. [PubMed] [Google Scholar]
18. Polz Grand F, Cavanaugh C M. A simple method for the quantification of uncultured microorganisms in the surroundings based on in vitro transcription of 16S rRNA. Appl Environ Microbiol. 1997;63:1028–1033. [PMC complimentary commodity] [PubMed] [Google Scholar]
19. Raskin L, Poulsen L K, Noguera D R, Rittmann B East, Stahl D A. Quantification of methanogenic groups in anaerobic biological reactors by oligonucleotide probe hybridization. Appl Environ Microbiol. 1994;60:1241–1248. [PMC free commodity] [PubMed] [Google Scholar]
xx. Raskin L, Stromley J G, Rittmann B Eastward, Stahl D A. Group-specific 16S rRNA hybridization probes to describe natural communities of methanogens. Appl Environ Microbiol. 1994;lx:1232–1240. [PMC free article] [PubMed] [Google Scholar]
21. Reysenbach A-L, Giver L J, Wickham G Southward, Step N R. Differential amplification of rRNA genes by polymerase chain reaction. Appl Environ Microbiol. 1992;58:3417–3418. [PMC free article] [PubMed] [Google Scholar]
22. Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Common cold Leap Harbor, North.Y: Cold Spring Harbor Laboratory; 1989. [Google Scholar]
23. Sardelli A D. Plateu outcome—understanding PCR limitations. Amplifications. 1993;9:i–v. [Google Scholar]
24. Splinter P Fifty, Rott One thousand A. Abstracts of the 97th Full general Meeting of the American Social club for Microbiology 1997. Washington, D.C: American Society for Microbiology; 1997. Physical and genetic map of Vibrio fischeri MJ1, abstr. H-212; p. 636. [Google Scholar]
25. Stahl D A, Flesher B, Mansfield H R, Montgomery Fifty. Apply of phylogenetically based hybridization probes for studies of ruminal microbial ecology. Appl Environ Microbiol. 1988;54:1079–1084. [PMC free article] [PubMed] [Google Scholar]
26. Steffan R J, Atlas R One thousand. Polymerase chain reaction: applications in environmental microbiology. Annu Rev Microbiol. 1991;45:137–161. [PubMed] [Google Scholar]
27. Suzuki 1000, Giovannoni S J. Bias caused by template annealing in the distension mixtures of 16S rRNA genes past PCR. Appl Environ Microbiol. 1996;62:625–630. [PMC costless article] [PubMed] [Google Scholar]
28. Torsvik V, Goksøyr J, Daae F L. High variety in Dna of soil bacteria. Appl Environ Microbiol. 1990;56:782–787. [PMC free article] [PubMed] [Google Scholar]
29. Wagner A, Blackstone N, Cartwright P, Dick M, Misof B, Snowfall P, Wagner G P, Bartels J, Murtha Chiliad, Pendleton J. Surveys of gene families using polymerase chain reaction: PCR selection and PCR drift. Syst Biol. 1994;43:250–261. [Google Scholar]
30. Zheng D, Alm E W, Stahl D A, Raskin Fifty. Characterization of universal pocket-sized-subunit rRNA hybridization probes for quantitative molecular microbial ecology studies. Appl Environ Microbiol. 1996;62:4504–4513. [PMC free commodity] [PubMed] [Google Scholar]
Articles from Applied and Environmental Microbiology are provided here courtesy of American Club for Microbiology (ASM)
What Is The Approximate Size Of Your Pcr Product Based On These Results?,
Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106531/
Posted by: saenzfany1994.blogspot.com
0 Response to "What Is The Approximate Size Of Your Pcr Product Based On These Results?"
Post a Comment